Human HAPLN1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_001884.3

RefSeq ORF Size

1065bp

Gene Synonym

CRTL1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human hyaluronan and proteoglycan link protein 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Hyaluronan (HA) is a high MW glycosaminoglycan significantly involved in the formation and stability of extracellular matrix via its association with specific HA-binding proteins. HAPLN1, also known as CRTL1 (Cartilage Link Protein 1, cLP ) and link protein, is a member of HA-binding protein (hyaladherins) family, and contains a common structural domain of about 100 amino acids that is termed a Link module with two α-helices and two antiparallel β-sheets. HAPLN1/CRTL1 stabilizes the interaction between hyaluronan (HA) and versican, two extracellular matrix components essential for cardiac development. Link module superfamily can be divided into three subgroups, and the HAPLN family are C domain-type proteins that have an extended structure with one N-terminal V-type Ig-like domain followed by two link modules. In cartilage, aggrecan forms - cLP stabilized aggregates with HA that provides the tissue with its load bearing properties. HAPLN1 is a component of follicular matrix, was shown to enhance cumulus-oocyte complex (COC) expansion in vitro. HAPLN1 may promote periovulatory granulosa cell survival, which would facilitate their differentiation into luteal cells.

References

Sun GW, et al. (2003) Follicle-stimulating hormone and insulin-like growth factor I synergistically induce up-regulation of cartilage link protein (Crtl1) via activation of phosphatidylinositol-dependent kinase/Akt in rat granulosa cells. Endocrinology. 144(3): 793-801.

Wirrig EE, et al. (2007) Cartilage link protein 1 (Crtl1), an extracellular matrix component playing an important role in heart development. Dev Biol. 310(2): 291-303.

Liu J, et al. (2010) Periovulatory expression of hyaluronan and proteoglycan link protein 1 (Hapln1) in the rat ovary: hormonal regulation and potential function. Mol Endocrinol. 24(6): 1203-17.

Catalog Number:HGD478-CY