Human HAO1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_017545.2

RefSeq ORF Size

1113bp

Gene Synonym

GOX, GOX1, HAOX1, MGC142225, MGC142227, HAO1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human hydroxyacid oxidase (glycolate oxidase) 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Hydroxyacid oxidase 1, also known as Glycolate oxidase, HAO1 and GOX1, is a member of the FMN-dependent alpha-hydroxy acid dehydrogenase family. HAO1 / GOX1 has 2-hydroxyacid oxidase activity. It is most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2-hydroxy octanoate. HAO1 / GOX1 is a liver-specific peroxisomal enzyme that oxidizes glycolate to glyoxylate with concomitant production of H2O2. In Hao1 messenger RNA (mRNA), an iron-responsive element (IRE) homologous to the sequence recognized by iron regulatory proteins (IRP), key regulators of iron homeostasis, is present. Mammalian HAO1 / GOX1 is a peroxisomal protein and that the C-terminal sequence SKI acts as the targeting signal. Down-regulation of HAO1 / GOX1 expression during oxidative stress may provide a mechanism to prevent excessive H2O2 formation in liver peroxisomes and may represent the prototype of a poorly recognized but potentially relevant response to oxidative injury involving down-regulation of ROS-producing enzymes.

References

Jones J.M.et al., 2000, J. Biol. Chem. 275:12590-7.

Recalcati,S. et al., 2001, J Cell Sci. 114 (Pt 9):1625-9.

Recalcati,S. et al., 2003, Hepatology. 38 (5):1159-66.

Murray M.S.et al., 2008, Biochemistry 47:2439-49.

Bourhis J.M.et al., 2009, Acta Crystallogr. F 65:1246-53.

Catalog Number:HGD476-CM