Human GPHA2 / glycoprotein hormone alpha 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGD239-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
390bp
Gene Synonym
A2, GPA2, ZSIG51, GPHA2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glycoprotein hormone alpha 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GPHA2 is a member of the glycoprotein hormones subunit alpha family. Glycoprotein hormones consist of two subunits, the common alpha- and specific beta-subunits, which associate noncovalently to form a heterodimer. The alpha-subunit combines with four distinct beta-subunits giving rise to four biologically active hormones in human: FSH, LH, TSH, and CG. GPHA2 and glycoprotein hormone beta 5 (GPHB5) can form a noncovalent heterodimer. GPHA2 can be detected in a variety of tissues. Recombinant A2/B5 heterodimeric glycoproteins activates human TSH receptors, but not LH and FSH receptors, and shows high affinity to TSH receptors in a radioligand receptor assay. The heterodimer also stimulates cAMP production and thymidine incorporation by cultured thyroid cells and increases serum thyroxine levels in TSH-suppressed rats in vivo. This new heterodimeric glycoprotein hormone was named as thyrostimulin based on its thyroid-stimulating activity. The expression of thyrostimulin in the anterior pituitary known to express TSH receptors suggested a paracrine mechanism.
References
  • Hsu SY. et al., 2002, Science. 295 (5555): 671-4.
  • Suzuki C. et al., 2007, Regul Pept. 142 (1-2): 60-7.
  • Breous E. et al., 2006, Mol Cell Endocrinol. 245 (1-2): 169-80.
  • TOP