Human GOPC / PIST Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGD217-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1365bp
Gene Synonym
CAL, FIG, PIST, GOPC1, dJ94G16.2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human golgi-associated PDZ and coiled-coil motif containing Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GOPC, also known as PIST, interacts specifically with TC10 (a Rho-family small GTPase)] as a binding partner for Rhotekin. Rhotekin associates with PIST in vitro and in both polarized and non-polarized MDCK (Madin-Darby canine kidney) cells. The C-terminal SPV (Ser-Pro-Val) motif of Rhotekin binds to the PDZ domain of PIST. The co-localization of PIST and Rhotekin at the Golgi apparatus can be detected in non-polarized fibroblast-like MDCK cells and AJs (adherens junctions) in the fully polarized cells. PIST and Rhotekin are recruited from the cytosol to AJs as the cell becomes polarized. Expression of constitutively active Rho or prevention of Rhotekin-PIST interaction induced diffuse cytoplasmic distribution of Rhotekin in polarized MDCK cells. GOPC may regulate CFTR chloride currents and acid-induced ACCN3 currents by modulating cell surface expression of both channels. It may also regulate the intracellular trafficking of the ADR1B receptor. GOPC is ubiquitously expressed and its overexpression results in CFTR intracellular retention and degradation in the lysosomes.
References
  • Hicks SW. et al., 2005, J Biol Chem. 280 (32): 28944-51.
  • Ito H. et al., 2006, Biochem J Aug. 397 (3): 389-98.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • TOP