Human GOLM1/GP73 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGD215-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1206bp
Gene Synonym
GP73, GOLPH2, C9orf155, FLJ22634, FLJ23608, PSEC0257, bA379P1.3, GOLM1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human golgi membrane protein 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Golgi membrane protein 1, also known as Golgi membrane protein GP73, Golgi phosphoprotein 2 and GOLM1, is a protein which belongs to the GOLM1 / CASC4 family. GOLM1 is widely expressed. It is highly expressed in colon, prostate, trachea and stomach. It is expressed at lower level in testis, muscle, lymphoid tissues, white blood cells and spleen. It is predominantly expressed by cells of the epithelial lineage. GOLM1 is expressed at low level in normal liver. Expression significantly increases in virus (HBV, HCV) infected liver. Expression of GOLM1 does not increase in liver disease due to non-viral causes (alcohol-induced liver disease, autoimmune hepatitis). Increased expression in hepatocytes appears to be a general feature of advanced liver disease. In liver tissue from patients with adult giant-cell hepatitis (GCH), GOLM1 is strongly expressed in hepatocyte-derived syncitial giant cells. GOLM1 is constitutively expressed by biliary epithelial cells but not by hepatocytes.
References
TOP