Human GNG13 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Gene

Species

Human

NCBI Ref Seq

NM_016541.2

RefSeq ORF Size

204bp

Gene Synonym

h2-35, G(gamma)13, GNG13

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human guanine nucleotide binding protein (G protein), gamma 13 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-GFPSpark

Restriction Site

Protein Tag

GFPSpark

Tag Sequence

GTGAGCAAGGGC……GAGCTGTACAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

GFPSpark Tag Information

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

GNG13 is a subunit of heterotrimeric G proteins which consist of alpha, beta, and gamma subunits. Heterotrimeric G proteins are membrane bound GTPases that are linked to 7-TM receptors. They function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. They are involved as a modulator or transducer in various transmembrane signaling systems. Each G protein is composed of an alpha-, beta- and gamma-subunit and is bound to GDP in the 'off' state. Ligand-receptor binding results in detachment of the G protein, switching it to an 'on' state and permitting Galpha activation of second messenger signalling cascades. There are several types of Galpha proteins; in addition, some Gbetagamma subunits have active functions. Gbetagamma coupled to H1 receptors can activate PLA2 and Gbetagamma coupled to M1 receptors can activate KIR channels. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. GNG13 is a gamma subunit that is expressed in taste, retinal, and neuronal tissues and plays a key role in taste transduction.

References

Huang L, et al. (2000) Ggamma13 colocalizes with gustducin in taste receptor cells and mediates IP3 responses to bitter denatonium. Nat Neurosci. 2 (12): 1055-62.

Blake B L, et al. (2001) G beta association and effector interaction selectivities of the divergent G gamma subunit G gamma(13). J Biol Chem. 276 (52): 49267-74.

Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6 (9): 791-806.

Catalog Number:HGD198-NG