Mouse GMFB Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGD171-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
429bp
Gene Synonym
C79176; AI851627; D14Ertd630e; 3110001H22Rik; 3110001O16Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse glia maturation factor, beta Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GMFB is a nerve growth factor which belongs to the actin-binding proteins ADF family, GMF subfamily. GMFB is involved in nervous system development, angiogenesis and immune function. It is especially crucial for the nervous system. GMFB causes brain cell differentiation, stimulates neural regeneration and inhibits tumor cell proliferation. It contains 1 ADF-H domain and is phosphorylated after phorbol ester stimulation. GMFB overexpression in astrocytes results in the increase of BDNF production. GMFB expression is increased by exercise, thus BDNF is important for exercise-induction of BDNF.
References
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Zaheer S, et al. (2011) Augmented expression of glia maturation factor in Alzheimer's disease. Neuroscience. 194:227-33.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • TOP