Human Glypican 5/GPC5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGD155-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1719bp
Gene Synonym
GPC5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glypican 5 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glypican-5 (GPC5), is a cell membrane protein which belongs to the glypican family. The glypicans compose a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans that may play a role in the control of cell division and growth regulation. So far, six members (Glypican-1/GPC1, Glypican-2/GPC2, Glypican-3/GPC3, Glypican-4/GPC4, Glypican-5/GPC5, Glypican-6/GPC6) of this family are known in vertebrates. In adult, Glypican-5 is primarily expressed in the brain. It is also detected in fetal brain, lung and liver. Glypican-5 enhances the intracellular signaling of FGF2 and HGF. It alters the cellular distribution of FGF2. The properties of Glypican-5 make it an attractive target for therapeutic intervention in rhabdomyosarcomas and other tumors that amplify and/or overexpress its gene. Glypican-5 is over-expressed in lymphoma cell lines that had shown amplification. It is a likely target for amplification, and that over-expression of GPC5 may contribute to development and/or progression of lymphomas and other tumors.
References
  • Yu W, et al. (2003) GPC5 is a possible target for the 13q31-q32 amplification detected in lymphoma cell lines. J Hum Genet. 48(6): 331-5.
  • Williamson D, et al. (2007) Role for amplification and expression of glypican-5 in rhabdomyosarcoma. Cancer Res. 67(1): 57-65.
  • TOP