Human Glucosamine (N-acetyl)-6-Sulfatase Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGD142-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1659bp
Gene Synonym
G6S, MGC21274
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glucosamine (N-acetyl)-6-sulfatase Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glucosamine (N-acetyl)-6-sulfatase (GNS), also known as G6S, a hydrolase, which is one of the enzymes involved in heparan sulfate catabolism leading to lysosomal storage. GNS is required for the catabolism of the glycosaminoglycans (GAG) including heparin, heparan sulphate, and keratan sulphate through the hydrolysis of 6-sulfate group from the N-acetyl-D-glucosamine 6-sulfate units. Mucopolysaccharidosis type IIID (MPS IIID) is the least common of the four subtypes of Sanfilippo syndrome. It is caused by a deficiency of N-acetylglucosamine-6-sulphatase. A mutation in GNS resulting in MPS IIID indicates the potential utility of molecular diagnosis for this rare condition. As the least common type of the four subtypes of Sanfilippo syndrome, MPS IIID has profound mental deterioration, hyperactivity, and relatively mild somatic manifestations.
References
  • Fuchs W, et al. (1985) Intralysosomal formation and metabolic fate of N-acetylglucosamine 6-sulfate from keratan sulfate. Eur J Biochem. 151(3): 551-6.
  • Beesley CE, et al. (2003) Sanfilippo syndrome type D: identification of the first mutation in the N-acetylglucosamine-6-sulphatase gene. J Med Genet. 40(3): 192-4.
  • Mok A, et al. (2003) Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. 81(1): 1-5.
  • Elioglu NH, et al. (2009) A novel loss-of-function mutation in the GNS gene causes Sanfilippo syndrome type D. Genet Couns. 20(2): 133-9.
  • TOP