Mouse GFAP Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGD080-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1293bp
Gene Synonym
AI836096
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse glial fibrillary acidic protein Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GFAP is a cell-specific marker which belongs to the intermediate filament family. It can distinguish astrocytes from other glial cells during development. GFAP is expressed in cells lacking fibronectin. It is a type III intermediate filaments protein which contains three domains: the head, rod and tail domains. GFAP functions in many important entral nervous system (CNS) processes, including cell communication and the functioning of the blood brain barrier. Improper GFAP regulation can cause multiple disorders. Defects in GFAP is related to Alexander disease which is a rare disorder of the central nervous system. It is a progressive leukoencephalopathy whose hallmark is the widespread accumulation of Rosenthal fibers which are cytoplasmic inclusions in astrocytes.
References
  • Buniatian G, et al., 1998, Biology of the cell. 90(1): 53-61.
  • Chen YS, et al., 2011, Experimental Cell Research. 317(16): 2252-66.
  • Isaacs A, et al., 1998, Genomics. 51(1): 152-4.
  • TOP