Human GCAP1 / GUCA1A Gene ORF cDNA clone expression plasmid,N terminal His tag

Gene

Species

Human

NCBI Ref Seq

BC031663

RefSeq ORF Size

606bp

Gene Synonym

COD3, GCAP, GUCA, GCAP1, GUCA1, CORD14, C6orf131, dJ139D8.6

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human guanylate cyclase activator 1A (retina) Gene ORF cDNA clone expression plasmid,N terminal His tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-His

Restriction Site

Protein Tag

His

Tag Sequence

CACCATCACCACCATCATCACCACCATCAC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

GCAP 1 gene plays a role in the recovery of retinal photoreceptors from photobleaching. In the recovery phase, the phototransduction messeneger cGMP is replenished by retinal guanylyl cyclase-1 (GC1). GC1 is activated by decreasing Ca(2+) concentrations following photobleaching. The protein encoded by this gene, guanylyl cyclase activating protein 1 (GCAP 1), mediates the sensitivity of GC1 to Ca(2+) concentrations. GCAP 1 promotes activity of GC1 at low Ca(2+) concentrations and inhibits GC1 activity at high Ca(2+) concentrations. Mutations in GCAP 1 gene cause autosomal dominant cone dystrophy (COD3); a disease characterized by reduced visual acuity associated with progressive loss of color vision. GCAP 1 stimulates guanylyl cyclase 1 (GC1) when free calcium ions concentration is low and inhibits GC1 when free calcium ions concentration is elevated. This Ca(2+)-sensitive regulation of GC is a key event in recovery of the dark state of rod photoreceptors following light exposure.

References

Surguchov A, et al. (1997) The human GCAP1 and GCAP2 genes are arranged in a tail-to-tail array on the short arm of chromosome 6 (p21.1). Genomics. 39(3):312-22.

Subbaraya I, et al. (1995) Molecular characterization of human and mouse photoreceptor guanylate cyclase-activating protein (GCAP) and chromosomal localization of the human gene. J Biol Chem. 269(49):31080-9.

Payne AM, et al. (1998) A mutation in guanylate cyclase activator 1A (GCAP 1) in an autosomal dominant cone dystrophy pedigree mapping to a new locus on chromosome 6p21.1. Hum Mol Genet. 7(2):273-7.

Catalog Number:HGD051-NH