Human GADD45A/DDIT1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:HGC985-NG

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
498bp
Gene Synonym
DDIT1, GADD45, GADD45A
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human growth arrest and DNA.-damage-inducible, alpha Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GADD45A is a member of the GADD45 Family, and has been found to associate with several cytoplasmic and nuclear factors and has been implicated in several cellular functions, including MAPK signaling, cell cycle regulation, DNA repair and genomic stability, apoptosis, and immune responses. The GADD45 Family of genes is rapidly induced by different stressors, including differentiation-inducing cytokines, and there is a large body of evidence that their cognate proteins are key players in cellular stress responses. GADD45A protein has been reported to interact with multiple important cellular proteins, including Cdc2 protein kinase, proliferating cell nuclear antigen (PCNA), p21Waf1/Cip1 protein, core histone protein and MTK/MEKK4, an up-stream activator of the JNK/SAPK pathway, indicating that GADD45A may play important roles in the control of cell cycle checkpoint, DNA repair process, and signaling transduction. GADD45A expression in response to genotoxic stress illustrates a more complex scenario, wherein transcriptional changes operate in concert with mRNA turnover and translational regulation. GADD45A was the first stress-inducible gene determined to be up-regulated by p53 and is also a target for the p53 homologues, p63 and p73. The decreased GADD45A expression is also considered a survival mechanism, as cancer cells without this control can evade the apoptotic pathway leading to increased tumourigenesis. As GADD45A is an essential component of many metabolic pathways that control proliferating cancer cells, it presents itself as an emerging drug target worthy of further investigation.
References
  • Zhan Q. (2005) Gadd45a, a p53- and BRCA1-regulated stress protein, in cellular response to DNA damage. Mutat Res. 569(1-2): 133-43.
  • Lal A, et al. (2006) Egad, more forms of gene regulation: the gadd45a story. Cell Cycle. 5(13): 1422-5.
  • Hoffman B, et al. (2007) Role of gadd45 in myeloid cells in response to hematopoietic stress. Blood Cells Mol Dis. 39(3): 344-7.
  • Rosemary Siafakas A, et al. (2009) Growth arrest and DNA damage-45 alpha (GADD45alpha). Int J Biochem Cell Biol. 41(5): 986-9.
  • TOP