Human G-CSF/CSF3 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGC956-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
624bp
Gene Synonym
CSF3, GCSF, G-CSF
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human colony stimulating factor 3 (granulocyte), transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family of hormone-like glycoproteins. It is produced by numerous cell types including immune and endothelial cells. G-CSF binding to its receptor G-CSF-R which belongs to the cytokine receptor type I family depends on the interaction of alpha-helical motifs of the former and two fibronectin type III as well as an immunoglobulin-like domain of the latter. Recent animal studies have also revealed that G-CSF activates multiple signaling pathways, such as Akt and also the Janus family kinase-2 and signal transducer and activation of transcription-3 (Jak2-STAT3) pathway, thereby promoting survival, proliferation, differentiation and mobilisation of haematopoietic stem and progenitor cells. G-CSF is a cytokine that have been demonstrated to improve cardiac function and perfusion in myocardial infarction. And it was initially evaluated as a stem cell mobilizer and erythropoietin as a cytoprotective agent. G-CSF prevents left ventricular remodeling after myocardial infarction by decreasing cardiomyocyte death and by increasing the number of blood vessels, suggesting the importance of direct actions of G-CSF on the myocardium rather than through mobilization and differentiation of stem cells. Accordingly, recombinant human (rh)G-CSF has been extensively used in clinical haematology and oncology to enable bone marrow transplantation or to treat chemotherapy-associated neutropenia. In preclinical study, G-CSF improved cardiac function and perfusion by angiomyogenesis and protection of cardiomyocytes in myocardial infarction.
References
  • Takano H, et al. (2007) G-CSF therapy for acute myocardial infarction. Trends Pharmacol Sci. 28(10): 512-7.
  • Klocke R, et al. (2008) Granulocyte colony-stimulating factor (G-CSF) for cardio- and cerebrovascular regenerative applications. Curr Med Chem. 15(10): 968-77.
  • Kang HJ, et al. (2008) G-CSF- and erythropoietin-based cell therapy: a promising strategy for angiomyogenesis in myocardial infarction. Expert Rev Cardiovasc Ther. 6(5): 703-13.
  • Beekman R, et al. (2010) G-CSF and its receptor in myeloid malignancy. Blood. 115(25): 5131-6.
  • TOP