Human FUT8 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_178154.1

RefSeq ORF Size

1728bp

Gene Synonym

MGC26465, FUT8

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human fucosyltransferase 8 (alpha (1,6) fucosyltransferase) Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Alpha (1,6) fucosyltransferase 8, also known as FUT8, is a member of the glycosyltransferase family. Fucosyltransferases are the enzymes transferring fucose from GDP-Fuc to Gal in an alpha1,2-linkage and to GlcNAc in alpha1,3-linkage, alpha1,4-linkage, or alpha1,6-linkage. All fucosyltransferases utilize the same nucleotide sugar, their specificity reside in the recognition of the acceptor and in the type of linkage formed. Fucosyltransferases share some common structural and catalytic features. On the basis of protein sequence similarities, these enzymes can be classified into four distinct families: (1) the alpha-2-fucosyltransferases, (2) the alpha-3-fucosyltransferases, (3) the mammalian alpha-6-fucosyltransferases, and (4) the bacterial alpha-6-fucosyltransferases. The alpha-3-fucosyltransferases constitute a distinct family as they lack the consensus peptide, but some regions display similarities with the alpha-2 and alpha-6-fucosyltranferases.

References

Breton C, et al. (1998) Conserved structural features in eukaryotic and prokaryotic fucosyltransferases. Glycobiology. 8(1): 87-94.

Oriol R, et al. (1999) Divergent evolution of fucosyltransferase genes from vertebrates, invertebrates, and bacteria. Glycobiology. 9(4): 323-34.

de Vries T, et al. (2001) Fucosyltransferases: structure / function studies. Glycobiology. 11(10): 119-128.

Baboval T, et al. (2002) Comparison of human and mouse Fuc-TX and Fuc-TXI genes, and expression studies in the mouse. Mamm Genome. 13(9): 538-41.

Catalog Number:HGC943-NY