Human Fumarate Hydratase Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGC931-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1533bp
Gene Synonym
MCL, LRCC, HLRCC, MCUL1, FH
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fumarate hydratase Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fumarate Hydratase (FH) is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. Fumarate Hydratase is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. Individuals with hemizygous germline fumarate hydratase (FH) mutations are predisposed to renal cancer. These tumors predominantly exhibit functional inactivation of the remaining wild-type allele, implicating FH inactivation as a tumor-promoting event.
References
  • King A, et al. (2005) Succinate dehydrogenase and fumarate hydratase: linking mitochondrial dysfunction and cancer. Oncogene. 25(34): 4675-82.
  • Alam NA, et al. (2003) Genetic and functional analyses of FH mutations in multiple cutaneous and uterine leiomyomatosis, hereditary leiomyomatosis and renal cancer, and fumarate hydratase deficiency. Hum Mol Genet.12(11): 1241-52.
  • Pollard PJ, et al. (2003) The TCA cycle and tumorigenesis: the examples of fumarate hydratase and succinate dehydrogenase. Ann Med. 35(8): 632-9.
  • TOP