Human FUCA1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC017338

RefSeq ORF Size

1386bp

Gene Synonym

RP11-45G17.1, FUCA, FUCA1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human fucosidase, alpha-L- 1, tissue Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FUCA1 is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in FUCA1 gene are associated with fucosidosis (FUCA1D), which is an autosomal recessive lysosomal storage disease. Different phenotypes include clinical features such as neurologic deterioration, growth retardation, visceromegaly, and seizures in a severe early form; coarse facial features, angiokeratoma corporis diffusum, spasticity and delayed psychomotor development in a longer surviving form; and an unusual spondylometaphyseoepiphyseal dysplasia in yet another form.

References

Yang M, et al. (1993) A mutation generating a stop codon in the alpha-L-fucosidase gene of a fucosidosis patient. Biochem Biophys Res Commun. 189(2):1063-8.

Fukushima H, et al. (1991) Sequencing and expression of a full-length cDNA for human alpha-L-fucosidase. J Inherit Metab Dis. 13(5):761-5.

Kretz KA, et al. (1990) Characterization of EcoRI mutation in fucosidosis patients: a stop codon in the open reading frame. J Mol Neurosci. 1(3):177-80.

Catalog Number:HGC928-NF