Mouse FTLS / RSPO2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGC922-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
732bp
Gene Synonym
ftls, AA673245
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse R-spondin 2 homolog Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
R-spondin-2, also known as RSPO2, synergizes with Wnt to activate beta-catenin. RSPO2 is secreted proteins that regulate beta-catenin signaling. Activator of the beta-catenin signaling cascade leads to TCF-dependent gene activation. Action both in the canonical Wnt / beta- catenin-dependent pathway, possibly via a direct interaction with Wnt proteins, and in a Wnt-independent beta catenin pathway through a receptor signaling pathway that may not use frizzled / LRP receptors. Probably also acts as a ligand for frizzled and LRP receptors. The encoding gene Rspo2 was identified as a novel common integration site for the mouse mammary tumor virus in viral induced mouse mammary tumors. Rspo2 and Rspo2 / Wnt1 tumors contained many spindle cells, consistent with an epithelial-mesenchymal transformation phenotype. When Rspo2 and Rspo2 / Wnt1 tumor cells were transferred into naive mice, they exhibited greater metastatic activity than cells derived from Wnt1 tumors.
References
  • Cadieu E, et al. (2009) Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science. 326: 150-153.
  • Kazanskaya O, et al. (2004) R-Spondin2 is a secreted activator of Wnt / beta-catenin signaling and is required for Xenopus myogenesis. Dev Cell. 7(4): 525-34.
  • Parker HG, et al. (2010) An insertion in the RSPO2 gene correlates with improper coat in the Portuguese water dog. J Hered. 101(5):612-7.
  • TOP