Rat FTH1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGC919-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
549bp
Gene Synonym
Fth
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ferritin, heavy polypeptide 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FTH1 (ferritin, heavy polypeptide 1) is the heavy subunit of ferritin which is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. FTH1 gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. FTH1 stores iron in a soluble, non-toxic, readily available form. It is important for iron homeostasis. It has ferroxidase activity. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. It also plays a role in delivery of iron to cells. FTH1 mediates iron uptake in capsule cells of the developing kidney.
References
  • Hentze MW, et al. (1986) Cloning, characterization, expression, and chromosomal localization of a human ferritin heavy-chain gene. Proc Natl Acad Sci. 83(19):7226-30.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Stelzl, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-968.
  • TOP