Human FSTL5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_020116.3

RefSeq ORF Size

2544bp

Gene Synonym

FSTL5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human follistatin-like 5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FSTL5 may have molecular function (calcium ion binding) and to localize in various compartments (cytoplasm, extracellular space, extracellular region). FSTL5 expression denoted a dismal prognosis both within and across medulloblastoma subgroups. FSTL5 gene is well expressed, 1.0 times the average gene in this release. The sequence of this gene is defined by 120 GenBank accessions from 113 cDNA clones, some from brain, cerebellum, eye, melanotic melanoma, skin, amygdala, breast and 24 other tissues. FSTL5 gene contains 27 distinct introns. The addition of FSTL5 immunohistochemistry to existing molecular stratification schemes constitutes a reliable and cost-effective tool for prognostication in future clinical trials of medulloblastoma.

References

Masuda T, et al. (2009) Laser capture microdissection and cDNA array analysis for identification of mouse KIAA/FLJ genes differentially expressed in the embryonic dorsal spinal cord. Brain Res. 1249:61-7.

Kingwell K. (2011) FSTL5--a new prognostic biomarker for medulloblastoma. Nat Rev Neurol. 7(11):598.

Remke M, et al. (2011) FSTL5 is a marker of poor prognosis in non-WNT/non-SHH medulloblastoma. J Clin Oncol. 29(29):3852-61.

Catalog Number:HGC918-NM