Mouse FOLR2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGC885-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
756bp
Gene Synonym
FBP2, FR-P3, Folbp2, Folbp-2, Folr2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse folate receptor 2 (fetal) Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Folate receptor beta, also known as Folate receptor 2, FBP, and FOLR2, is a member of the folate receptor family. FOLR2 is expressed in placenta and hematopoietic cells. The expression of FOLR2 is increased in malignant tissues. Members of the Folate receptor family members (FOLRs) have a high affinity for folic acid and for several reduced folic acid derivatives. They mediate the delivery of 5-methyltetrahydrofolate to the interior of, out of within, or between cells in a process known as potocytosis. FOLR2 has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. The FOLR2 protein was originally thought to exist only in placenta, but is also detected in spleen, bone marrow, and thymus. FOLR2 is a marker for macrophages generated in the presence of M-CSF, but not GM-CSF. Its expression correlates with increased folate uptake ability. Folate conjugates of therapeutic drugs are a potential immunotherapy tool to target tumor-associated macrophages.
References
  • van Heyningen V, et al., 1995, Cytogenet Cell Genet. 69 (3-4): 127-58.
  • Sabharanjak, S. et al., 2004, Adv Drug Deliv Rev. 56 (8): 1099-109. 
  • Scapoli, L. et al., 2005, Am J Med Genet A. 132A (3): 302-4.
  • Puig-Kröger, A. et al., 2009, Cancer Res  69 (24): 9395-403.
  • TOP