Mouse FLRT2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGC869-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1983bp
Gene Synonym
KIAA0405, Flrt2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse fibronectin leucine rich transmembrane protein 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fibronectin Leucine-Rich Transmembrane (FLRT) proteins are glycosylated membrane proteins expressed at the cell surface which localise in a homophilic manner to cell-cell contacts expressing the focal adhesion marker vinculin. FLRT1, FLRT2, and FLRT3, the three genes encode putative type I transmembrane proteins, each containing 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT family members may function in cell adhesion and/or receptor signalling. Each member of the FLRT family has a distinct, highly regulated expression pattern, as was seen for the NLRR family. FLRT2 is expressed in a subset of the sclerotome, adjacent to the region that forms the syndetome, suggesting that interaction with FGF signalling may be a general property of FLRT proteins. All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. FLRT proteins have a dual role, promoting FGF signalling and modulating homotypic cell adhesion. FLRT2 played critical roles in craniofacial development, and it was also present in the vomero-nasal organ, mandibular primodia, and the posterior aspects of the unfused and fused secondary palatal shelves.
References
  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 9(7): 497-502.
  • TOP