Human FGF19 / FGF-19 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC017664

RefSeq ORF Size

651bp

Gene Synonym

FGF19

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human fibroblast growth factor 19 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FGF19, also known as FGF-19, is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF19 interacts with FGFR1, FGFR2, FGFR3 and FGFR4. Affinity between fibroblast growth factors (FGFs) and their receptors is increased by KL, KLB and heparan sulfate glycosaminoglycans that function as coreceptors. It interacts with KL and KLB directly. However, it interacts with FGFR4 in the presence of heparin, KL or KLB. FGF19 is involved in the suppression of bile acid biosynthesis through down-regulation of CYP7A1 expression, following positive regulation of the JNK and ERK1/2 cascades. It also stimulates glucose uptake in adipocytes.

References

Tamimi Y, et al. (2006) FGF19 is a target for FOXC1 regulation in ciliary body-derived cells. Hum Mol Genet. 15(21):3229-40.

Goetz R, et al. (2007) Molecular insights into the klotho-dependent, endocrine mode of action of fibroblast growth factor 19 subfamily members. Mol Cell Biol. 27(9):3417-28.

Harmer NJ, et al. (2004) The crystal structure of fibroblast growth factor (FGF) 19 reveals novel features of the FGF family and offers a structural basis for its unusual receptor affinity. Biochemistry. 43(3):629-40.

Catalog Number:HGC804-CM