Human FGF-13 / FGF17 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGC791-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
651bp
Gene Synonym
HH20, FGF-13
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibroblast growth factor 17 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FGF-13, also known as FGF17, belongs to the fibroblast growth factor (FGF) family. Members of this family show broad mitogenic and cell survival activities, and play a role in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-13 is preferentially expressed in the embryonic brain. It interacts with FGFR3 and FGFR4. FGF-13 plays an important role in the regulation of embryonic development and as signaling molecule in the induction and patterning of the embryonic brain. It is also required for normal brain development.
References
  • Polnaszek N, et al. (2004) FGF17 is an autocrine prostatic epithelial growth factor and is upregulated in benign prostatic hyperplasia. Prostate. 60(1):18-24.
  • Xu J, et al. (2000) Temporal and spatial gradients of Fgf8 and Fgf17 regulate proliferation and differentiation of midline cerebellar structures. Development. 127(9):1833-43.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • TOP