Human FES/Feline sarcoma oncogene Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGC786-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2469bp
Gene Synonym
FPS, FES
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human feline sarcoma oncogene Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Proto-oncogene tyrosine-protein kinase Fes/Fps, also known as Proto-oncogene c-Fes, Proto-oncogene c-Fps, Feline sarcoma oncogene, FES and FPS, is a protein which contains one FCH domain, one protein kinase domain and one SH2 domain. FES is a non-receptor protein tyrosine kinase expressed in hematopoietic progenitors and differentiated myeloid cells. FES is observed in the nuclear, granular and plasma membrane fractions of primary human neutrophils and the myeloid leukemia cell line, HL-60. The nuclear localization is confirmed by immunocytochemistry of neutrophils. FES has been implicated in granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3) and erythropoietin signal transduction. FES has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. FES is also involved in normal hematopoiesis. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia.
References
  • Bowden DW, et al.,1991, Nucleic acids Res 19 (15): 4311.
  • Yates,K.E. et al., 1995, Oncogene. 10 (6):1239-42.
  • Jücker, M, et al.,1997, J. Biol. Chem.  272 (4): 2104-9.
  • Smithgall,T.E. et al., 1998, Crit Rev Oncog. 9 (1):43-62.
  • Lionberger, et al.,2000, Cancer Res. 60 (4): 1097-103.
  • TOP