Mouse FcERI/FCER1A Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGC765-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
753bp
Gene Synonym
FcERI, Fce1a, Fcr-5, fcepsilonri, Fcer1a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Fc receptor, IgE, high affinity I, alpha polypeptide Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FcERI, also known as FCER1A, is the alpha subunit of the immunoglobulin epsilon receptor (IgE receptor). IgE receptor is a high affinity IgE receptor which plays a central role in allergic disease, coupling allergen and mast cell to initiate the inflammatory and immediate hypersensitivity responses that are characteristic of disorders such as hay fever and asthma. The allergic response occurs when 2 or more IgE receptors are crosslinked via IgE molecules that in turn are bound to an allergen (antigen) molecule. A perturbation occurs that brings about the release of histamine and proteases from the granules in the cytoplasm of the mast cell and leads to the synthesis of prostaglandins and leukotrienes--potent effectors of the hypersensitivity response. IgE receptor is comprised of an alpha subunit(FcERI), a beta subunit, and two gamma subunits. FcERI is glycosylated and contains 2 Ig-like (immunoglobulin-like) domains.
References
  • Shikanai T, et al. (2002) Sequence variants in the FcepsilonRI alpha chain gene. J Appl Physiol. 93(1):37-41.
  • Sada K, et al. (2002) Regulation of FcepsilonRI-mediated degranulation by an adaptor protein 3BP2 in rat basophilic leukemia RBL-2H3 cells. Blood. 100(6):2138-44.
  • Takahashi K, et al. (2003) Transcriptional regulation of the human high affinity IgE receptor alpha-chain gene. Mol Immunol. 38(16-18):1193-9.
  • TOP