Rat Fas Ligand / FASLG / CD95L Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGC725-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
837bp
Gene Synonym
Fasl, CD95-L, Tnfsf6, Apt1Lg1, Faslg
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Fas ligand (TNF superfamily, member 6) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fas Ligand, also known as FASLG and CD95L, is the ligand for FAS. It is a transmembrane protein which binds to TNFRSF6/FAS. Interaction of FAS with fas Ligand is critical in triggering apoptosis of some types of cells such as lymphocytes. Fas Ligand may be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both.
References
  • Pitti R M. et al., 1998, Nature. 396 (6712): 699-703.
  • Hane M. et al., 1995, FEBS Lett. 373 (3): 265-8.
  • Schneider P. et al., 1997, J Biol Chem. 272 (30): 18827-33.
  • TOP