Mouse FAM3D / Oit1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGC693-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
672bp
Gene Synonym
EF-7, Fam3d, AV067083, MGC37550, 2310076N21Rik, Oit1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse oncoprotein induced transcript 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Family with sequence similarity 3 (FAM3) family is a novel cytokine-like gene family, which has four genes in this family, FAM3A, FAM3B, FAM3C, and FAM3D, each encoding a protein (224-235 amino acids) with a hydrophobic leader sequence. It had indicated that FAM3B/PANDER (pancreatic derived factor) is highly expressed in pancreas, and FAM3A and FAM3C in almost all tissues. FAM3D is abundantly expressed in placenta and weakly expressed in small intestine. Immunohistochemistry showed that FAM3A is expressed prominently in the vascular endothelium, particularly capillaries. FAM3A and FAM3B protein were both localized to the islets of Langerhans of the endocrine pancreas. Recombinant FAM3B protein has delayed effects on beta-cell function. FAM3C is involved in retinal laminar formation processes in vertebrates. NFATC2, SCP2, CACNA1C, TCRA, POLE, and FAM3D, were associated with narcolepsy. Some of these associations were further supported by gene expression analyses and an association study in essential hypersomnia (EHS), CNS hypersonia similar to narcolepsy.
References
  • Zhu Y, et al. (2002) Cloning, expression, and initial characterization of a novel cytokine-like gene family. Genomics. 80(2): 144-50.
  • Katahira T, et al. (2010) Secreted factor FAM3C (ILEI) is involved in retinal laminar formation. Biochem Biophys Res Commun. 392(3): 301-6.
  • Shimada M, et al. (2010) An approach based on a genome-wide association study reveals candidate loci for narcolepsy. Hum Genet. 128(4): 433-41.
  • TOP