Human ETHE1 / HSCO Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGC602-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
765bp
Gene Synonym
HSCO, YF13H12
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ethylmalonic encephalopathy 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ETHE1, also known as HSCO, is a sulfur dioxygenase that localizes within the mitochondrial matrix. ETHE1 probably plays an important role in metabolic homeostasis in mitochondria. It may also function as a nuclear-cytoplasmic shuttling protein that binds transcription factor RELA/NFKB3 in the nucleus and exports it to the cytoplasm. ETHE1 can suppresses p53-induced apoptosis by preventing nuclear localization of RELA. Mutations in ETHE1 gene result in ethylmalonic encephalopathy. Ethylmalonic encephalopathy is an autosomal recessive, invariably fatal disorder characterized by early-onset encephalopathy, microangiopathy, chronic diarrhea, defective cytochrome c oxidase (COX) in muscle and brain, high concentrations of C4 and C5 acylcarnitines in blood and high excretion of ethylmalonic acid in urine.
References
  • Higashitsuji. et al., 2002, Cancer Cell. 2 (4): 335-46.
  • McCoy JG. et al., 2007, Acta Crystallogr D Biol Crystallogr. 62 (9): 964-70.
  • Mehrle A. et al., 2006, Nucleic Acids Res. 34: D415-8.
  • TOP