Mouse ESM1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGC592-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
555bp
Gene Synonym
ESM-1, AV004503, 0610042H23Rik, Esm1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse endothelial cell-specific molecule 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ESM1 is a secreted protein which is produced by adipocytes. It has been noticed that ESM1 may play some role in obesity-associated vascular disease since circulating ESM-1 levels are reduced in the overweight and obese. ESM1 is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of ESM1 gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. Recently, ESM1 has been described as a specific biomarker of tip cells during neoangiogenesis. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF or FGF-2. In hypervascularized cancers, overexpression of endocan has been detected by immunohistochemistry using monoclonal antibodies against ESM1.
References
  • Cong R, et al. (2006) Hhex is a direct repressor of endothelial cell-specific molecule 1 (ESM-1). Biochem. Biophys Res Commun. 346(2):535-45.
  • Aitkenhead M, et al. (2002) Identification of endothelial cell genes expressed in an in vitro model of angiogenesis: induction of ESM-1, (beta)ig-h3, and NrCAM. Microvasc Res. 63(2): 159-71.
  • Lassalle P, et al. (1996) ESM-1 is a novel human endothelial cell-specific molecule expressed in lung and regulated by cytokines. J Biol Chem. 271(34):20458-64.
  • TOP