Rat Erythropoietin/EPO Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_017001.1

RefSeq ORF Size

579bp

Gene Synonym

Epo

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat erythropoietin Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Erythropoietin is a member of the EPO / TPO family. It is a secreted, glycosylated cytokine composed of four alpha helical bundles. Erythropoietin can be found in the plasma and regulates red cell production by promoting erythroid differentiation and initiating hemoglobin synthesis. It also has neuroprotective activity against a variety of potential brain injuries and antiapoptotic functions in several tissue types. Erythropoietin is the principal hormone involved in the regulation of erythrocyte differentiation and the maintenance of a physiological level of circulating erythrocyte mass. It is produced by kidney or liver of adult mammals and by liver of fetal or neonatal mammals. Genetic variation in erythropoietin is associated with susceptbility to microvascular complications of diabetes type 2. These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. It has a longer circulating half-life in vivo. Erythropoietin is being much misused as a performance-enhancing drug in endurance athletes.

References

Jelkmann W, et al. (2007) Erythropoietin after a century of research: younger than ever. Eur J Haematol. 78 (3):183-205.

Miyake T, et al. (1997) Purification of human erythropoietin. J Biol Chem. 252(15):5558-64.

Haroon ZA, et al. (2003) A novel role for erythropoietin during fibrin-induced wound-healing response. Am J Pathol. 163(3):993-1000.

Siren AL, et al. (2001) Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad Sci. 98(7):4044-9.

Catalog Number:HGC591-CM