Human EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGC561-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1008bp
Gene Synonym
EPO-R, MGC138358, EPOR
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human erythropoietin receptor, transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by kidney and liver in an oxygen-dependent manner. The biological effects of EPO are mediated by the specific erythropoietin receptor (EPOR/EPO Receptor) on bone marrow erythroblasts, which transmits signals important for both proliferation and differentiation along the erythroid lineage. EPOR protein is a type â…  single-transmembrane cytokine receptor, and belongs to the homodimerizing subclass which functions as ligand-induced or ligand-stabilized homodimers. EPOR signaling prevents neuronal death and ischemic injury. Recent studies have shown that EPO and EPOR protein may be involved in carcinogenesis, angiogenesis, and invasion.
References
  • Divoky V, et al. (2002) Mouse surviving solely on human erythropoietin receptor (EpoR): model of human EpoR-linked disease. Blood 99(10): 3873-4.
  • Carruthers SG. (2009) A truncated erythropoietin receptor EPOR-T is associated with hypertension susceptibility. Clin Pharmacol Ther. 86(2): 134-6.
  • Baltaziak M, et al. (2009) Relationships of P53 and Bak with EPO and EPOR in human colorectal cancer. Anticancer Res. 29(10):4151-6.
  • TOP