Mouse Ephrin-A4/EFNA4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGC551-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
621bp
Gene Synonym
Epl4, EFL-4, LERK-4, Efna4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Ephrin-A4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
EPH-related receptor tyrosine kinase ligand 4 (Ephrin-A4) also known as EFNA4, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. Ephrin-A4/EFNA4 functions as a cell surface GPI-bound ligand for Eph receptor, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development.
References
  • Aasheim HC, et al. (2000) A splice variant of human ephrin-A4 encodes a soluble molecule that is secreted by activated human B lymphocytes. Blood. 95(1): 221-30.
  • Moss A, et al. (2005) Ephrin-A4 inhibits sensory neurite outgrowth and is regulated by neonatal skin wounding. Eur J Neurosci. 22(10): 2413-21.
  • Cerretti DP, et al. (1998) Characterization of the genes for mouse LERK-3/Ephrin-A3 (Epl3), mouse LERK-4/Ephrin-A4 (Epl4), and human LERK-6/Ephrin-A2 (EPLG6): conservation of intron/exon structure. Genomics. 47(1): 131-5.
  • TOP