Mouse ENTPD5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGC523-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1284bp
Gene Synonym
Pcph, Cd39l4, mNTPase, AI196558, AI987697, NTPDase5, ER-UDPase, NTPDase-5, Entpd5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse ectonucleoside triphosphate diphosphohydrolase 5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5. This hydrolase is expressed in response to phosphoinositide 3-kinase (PI3K) signaling. Activation of PI3K results in FOXO phosphorylation by AKT1 and loss of ENTPD5 transcriptional repression. It is Up-regulated in PTEN-deficient cells. Uridine diphosphatase (UDPase) that promotes protein N-glycosylation and ATP level regulation.ENTPD5 promotes protein N-glycosylation and folding in the endoplasmic reticulum, as well as elevated ATP consumption in the cytosol via an ATP hydrolysis cycle. Together with CMPK1 and AK1, ENTPD5 constitutes an ATP hydrolysis cycle that converts ATP to AMP and results in a compensatory increase in aerobic glycolysis. ENTPD5 also hydrolyzes GDP and IDP but not any other nucleoside di-, mono- or triphosphates, nor thiamine pyrophosphate. This enzyme Plays a key role in the AKT1-PTEN signaling pathway by promoting glycolysis in proliferating cells in response to phosphoinositide 3-kinase (PI3K) signaling.
References
  • Villar J, et al. (2009) PCPH/ENTPD5 expression confers to prostate cancer cells resistance against cisplatin-induced apoptosis through protein kinase Calpha-mediated Bcl-2 stabilization. Cancer Res. 69(1): 102-10.
  • Fang M, et al. (2010) The ER UDPase ENTPD5 promotes protein N-glycosylation, the Warburg effect, and proliferation in the PTEN pathway. Cell. 143(5): 711-24.
  • Paez JG, et al. (2001) Identity between the PCPH proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphosphohydrolase gene. Int J Oncol. 19(6): 1249-54.
  • TOP