Cynomolgus ENSA / Endosulfine alpha Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGC519-NM

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
366bp
Gene Synonym
ENSA
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus endosulfine alpha Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Endosulfine alpha, also known as ENSA, belongs to the endosulfine family. It is a highly conserved cAMP-regulated phosphoprotein (ARPP) family. Endosulfine alpha is widely expressed with high levels in skeletal muscle and brain and lower levels in the pancreas. As a protein phosphatase inhibitor, ENSA specifically inhibits protein phosphatase 2A (PP2A) during mitosis. When phosphorylated at Ser-67 during mitosis, specifically interacts with PPP2R2D (PR55-delta) and inhibits its activity, leading to inactivation of PP2A, an essential condition to keep cyclin-B1-CDK1 activity high during M phase By similarity. Endosulfine alpha also acts as a stimulator of insulin secretion by interacting with sulfonylurea receptor (ABCC8), thereby preventing sulfonylurea from binding to its receptor and reducing K(ATP) channel currents.
References
  • Ye M. et al., 2001, Genome Res. 10 (10): 1546-60.
  • Apiou F. et al., 1999, Diabetes 48 (9): 1873-6.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • TOP