Human ENPP5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_021572.4

RefSeq ORF Size

1434bp

Gene Synonym

KIAA0879, ENPP5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ENPP5 is a member of the nucleotide pyrophosphatase/phosphodiesterase family(NPP). It is a family comprised by dimeric enzymes that catalyze the hydrolysis of phosphate diester bonds. There are seven isoforms in NPP family, some of which prefer nucleotide substrates, some of which prefer phospholipid substrates, and others of which prefer substrates that have not yet been determined. NPP also belongs to the alkaline phosphatase (AP) superfamily of enzymes and they are located in the cell membrane and hydrolyze extracellular phosphate diesters to affect a wide variety of biological processes. ENPP5 belongs to a group of nucleotidemetabolizing ectoenzymes, which regulate the availability of extracellular nucleotides. ENPP5 may play a role in neuronal cell communication. Hhowever, it lacks nucleotide pyrophosphatase and lysopholipase D activity. It may also be involved in neuronal cell communication. The amino acid sequence of human ENPP5 is 100%, 88%, and 82% identical to that of chimpanzee, dog and mouse/rat. ENPP5 functions in phospholipid metabolism.

References

Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.

Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.

Catalog Number:HGC517-NM