Human Endoglin/CD105 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGC501-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1977bp
Gene Synonym
Eng, END, ORW, HHT1, ORW1, CD105, FLJ41744
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human endoglin (ENG), transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.
References
TOP