Human EIF3K Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGC446-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
657bp
Gene Synonym
M9; ARG134; PLAC24; PTD001; EIF3S12; HSPC029; MSTP001; PLAC-24; PRO1474; EIF3-p28
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 3, subunit K Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
EIF3K is a member of the eIF3 subunit K family. It is a component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). It stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. EIF3K is universally expressed in human tissues. It is distributed both in nucleus and cytoplasm. EIF3K is the smallest subunit of eIF3 and it interacts with a number of other subunits of eIF3 and the 40S ribosomal subunit.
References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Shen X. et al., 2004, FEBS Lett. 573 (1-3): 139-46.
  • Wei Z. et al., 2004, J Biol Chem. 279 (33): 34983-90.
  • TOP