Human EIF-5A/EIF5 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGC422-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1296bp
Gene Synonym
EIF-5, EIF-5A
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 5 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 40S ribosome subunit.
References
  • Si K, et al. (1996) Charactatierizon of multiple mRNAs that encode mammalian translation initiation factor 5 (eIF-5). J Biol Chem. 71(28):16934.
  • Das S, et al. (1998) Specific interaction of eukaryotic translation initiation factor 5 (eIF5) with the beta-subunit of eIF2. J Biol Chem. 272(50):31712-8.
  • Conte MR, et al. (2006) Structure of the eukaryotic initiation factor (eIF) 5 reveals a fold common to several translation factors. Biochemistry. 45(14):4550-8.
  • TOP