Human DPY30 domain containing 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGC292-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
534bp
Gene Synonym
DYDC2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human DPY30 domain containing 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
DPY30 domain containing 2 belongs to the dpy-30 family. Dumpy-30 family members act as determinants of male fertility and interaction partners of metal-responsive transcription factor 1 (MTF-1) in Drosophila. MTF-1 plays a key role in transition metal detoxification and homeostasis. It binds to metal response elements (MREs). Two candidate dMTF-1 interactors are related to the small regulatory protein Dumpy-30 (Dpy-30) of the worm C. elegans. Dpy-30 is the founding member of a protein family involved in chromatin modifications, notably histone methylation. Mutants affect mating type in yeast and male mating in C. elegans. As part of the MLL1/MLL complex, DPY30 domain containing 2 is involved in methylation and dimethylation at 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. DPY30 domain containing 2 may also play an indirect or direct role in endosomal transport.
References
  • 1. Deloukas P, et al. (2004) The DNA sequence and comparative analysis of human chromosome 10. Nature. 429(6990):375-81.
  • 2. Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • 3. Xin X, et al. (2009) Shifted Transversal Design smart-pooling for high coverage interactome mapping. Genome Res. 19(7):1262-9.
  • TOP