Human DNMT2 / TRDMT1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_004412.4

RefSeq ORF Size

1176bp

Gene Synonym

DMNT2, DNMT2, PuMet, RNMT1, M.HsaIIP, TRDMT1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human tRNA aspartic acid methyltransferase 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

DNMT2, also known as tRNA (cytosine-5-)-methyltransferase, DNA methyltransferase homolog HsaIIP, and TRDMT1, is a member of the DNA methyltransferase family of enzymes. DNMT2 enzymes have been widely conserved during evolution and contain all of the signature motifs of DNA (cytosine-5)-methyltransferases. It contains all 10 sequence motifs that are conserved among m(5)C MTases, including the consensus S:-adenosyl-L-methionine-binding motifs and the active site ProCys dipeptide, and its structure is very similar to prokaryotic DNA methyltransferases. DNMT2 has close homologs in plants, insects and Schizosaccharomyces pombe, but no related sequence can be found in the genomes of Saccharomyces cerevisiae or Caenorhabditis elegans. While the biological function of DNMT2 is not yet known, the strong binding to DNA suggests that DNMT2 may mark specific sequences in the genome by binding to DNA through the specific target-recognizing motif. However, the DNA methyltransferase activity of these proteins is comparatively weak and their biochemical and functional properties remain enigmatic. Recent evidence now shows that Dnmt2 has a novel tRNA methyltransferase activity, raising the possibility that the biological roles of these proteins might be broader than previously thought.

References

Dong A, et al. (2001) Structure of human DNMT2, an enigmatic DNA methyltransferase homolog that displays denaturant-resistant binding to DNA. Nucleic Acids Res. 29(2): 439-48.

Hermann A, et al. (2003) The human Dnmt2 has residual DNA-(cytosine-C5) methyltransferase activity. J Biol Chem. 278(34): 31717-21.

Jeltsch A, et al. (2006) Two substrates are better than one: dual specificities for Dnmt2 methyltransferases. Trends Biochem Sci. 31(6): 306-8.

Schaefer M, et al. (2010) Solving the Dnmt2 enigma. Chromosoma. 119(1): 35-40.

Catalog Number:HGC260-CF