Mouse DMP1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGC236-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1512bp
Gene Synonym
PP; Dmp; AV020965
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse dentin matrix protein 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Dentin matrix acidic phosphoprotein (DMP1) is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. DMP1 contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation, DMP1 becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in DMP1 are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. DMP1 may have a dual function during osteoblast differentiation. In the nucleus of undifferentiated osteoblasts, unphosphorylated form acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the osteoblast to osteocyte transition phase it is phosphorylated and exported into the extracellular matrix, where it regulates nucleation of hydroxyapatite.
References
  • Aplin HM, et al. (1996) Mapping of the human dentin matrix acidic phosphoprotein gene (DMP1) to the dentinogenesis imperfecta type II critical region at chromosome 4q21. Genomics. 30 (2): 347-9.
  • Hirst KL, et al. (1997) Elucidation of the sequence and the genomic organization of the human dentin matrix acidic phosphoprotein 1 (DMP1) gene: exclusion of the locus from a causative role in the pathogenesis of dentinogenesis imperfecta type II. Genomics. 42 (1): 38-45.
  • Chen S, et al. (2005) Binding of two nuclear factors to a novel silencer element in human dentin matrix protein 1 (DMP1) promoter regulates the cell type-specific DMP1 gene expression. J Cell Biochem. 92 (2): 332-49.
  • TOP