Human DCX Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC027925

RefSeq ORF Size

1083bp

Gene Synonym

DC, DBCN, LISX, SCLH, XLIS, DCX

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human doubleco C terminal His tag. Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

DCX (doublecortin, N-GST chimera)contains 2 doublecortin domains and belongs to the doublecortin family. It is highly expressed in neuronal cells of fetal brain, but not expressed in other fetal tissues. In the adult, it is highly expressed in the brain frontal lobe, but very low expression in other regions of brain, and not detected in heart, placenta, lung, liver, skeletal muscles, kidney and pancreas. DCX is a microtubule-associated protein required for initial steps of neuronal dispersion and cortex lamination during cerebral cortex development. It may act by competing with the putative neuronal protein kinase DCAMKL1 in binding to a target protein. DCX may in that way participate in a signaling pathway that is crucial for neuronal interaction before and during migration, possibly as part of a calcium ion-dependent signal transduction pathway. It may be part with LIS-1 of a overlapping, but distinct, signaling pathways that promote neuronal migration. Defects in DCX are the cause of lissencephaly X-linked type 1 and subcortical band heterotopia X-linked.

References

Des Portes V, et al. (1998) A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome. Cell. 92:51-61.

Gleeson J G, et al. (998) Doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein. Cell. 92:63-72.

Ross M T, et al. (2005) The DNA sequence of the human X chromosome. Nature. 434:325-37.

Catalog Number:HGC104-CF