Mouse DCUN1D1 / SCCRO Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGC100-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
780bp
Gene Synonym
Rp42; Tes3; SCCRO; pTes3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
DCUN1D1, also known as SCCRO, is part of an E3 ubiquitin ligase complex for neddylation. DCUN1D1 functions to recruit charged E2 and is involved in the release of inhibitory effects of CAND1 on cullin-RING ligase E3 complex assembly and activity. DCUN1D1 binds to the components of the neddylation pathway (Cullin-ROC1, Ubc12, and CAND1) and augments but is not required for cullin neddylation in reactions using purified recombinant proteins. DCUN1D1 also recruits Ubc12 approximately NEDD8 to the CAND1-Cul1-ROC1 complex but that this is not sufficient to dissociate or overcome the inhibitory effects of CAND1 on cullin neddylation in purified protein assays. DCUN1D1 also acts as am ncogene facilitating malignant transformation and carcinogenic progression.
References
  • Heir P. et al., 2013, Mol Cell Biol. 33 (8): 1621-31.
  • Kurz T. et al., 2005, Nature. 435 (7046): 1257-61.
  • Kim AY. et al., 2008, J Biol Chem. 283 (48): 33211-20.
  • TOP