Human DCIR/CLEC4A/CLECSF6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_016184.3

RefSeq ORF Size

714bp

Gene Synonym

DCIR, LLIR, DDB27, CLECSF6, HDCGC13P, CLEC4A

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human C-type lectin domain family 4, member A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

KpnI + XbaI (6kb + 0.8kb)

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dendritic cell immunoreceptor (DCIR), also known as C-type lectin domain family 4 member A (CLEC4A), C-type lectin superfamily member 6 (CLECSF6), is a single-pass type II C-type lectin receptor expressed mainly in dendritic cells (DCs), which is a negative regulator of DC expansion and has a crucial role in maintaining the homeostasis of the immune system. The Dectin-2 family of C-type lectins that includes Dectin-2, BDCA-2, DCIR, DCAR, Clecsf8 and Mincle. These type II receptors contain a single extracellular carbohydrate recognition domain and have diverse functions in both immunity and homeostasis. DCIR is the only member of the family which contains a cytoplasmic signalling motif and has been shown to act as an inhibitory receptor, while BDCA-2, Dectin-2, DCAR and Mincle all associate with FcRgamma chain to induce cellular activation, including phagocytosis and cytokine production. Dectin-2 and Mincle have been shown to act as pattern recognition receptors for fungi, while DCIR acts as an attachment factor for HIV. In addition to pathogen recognition, DCIR has been shown to be pivotal in preventing autoimmune disease by controlling dendritic cell proliferation. DCIR expressed on antigen presenting cells and granulocytes and acts as an inhibitory receptor via an intracellular immunoreceptor tyrosine-based inhibitory motif (ITIM). It may also be involved via its ITIM motif in the inhibition of B-cell-receptor-mediated calcium mobilization and protein tyrosine phosphorylation. Additionally, DCIR can participate in the capture of HIV-1 and promote infection in trans and in cis of autologous CD4(+) T cells from human immature monocyte-derived DCs. DCIR acts as a ligand for HIV-1 and is involved in events leading to productive virus infection.

References

Kanazawa N, et al. (2004) Signaling and immune regulatory role of the dendritic cell immunoreceptor (DCIR) family lectins: DCIR, DCAR, dectin-2 and BDCA-2. Immunobiology. 209(1-2): 179-90.

Fujikado N, et al. (2008) Dcir deficiency causes development of autoimmune diseases in mice due to excess expansion of dendritic cells. Nat Med. 14(2): 176-80.

Lambert AA, et al. (2008) The C-type lectin surface receptor DCIR acts as a new attachment factor for HIV-1 in dendritic cells and contributes to trans- and cis-infection pathways. Blood. 112(4): 1299-307.

Graham LM, et al. (2009) The Dectin-2 family of C-type lectins in immunity and homeostasis. Cytokine. 48(1-2): 148-55.

Catalog Number:HGC087-CM