Human CTSZ / CTSX / Cathepsin Z Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_001336.2

RefSeq ORF Size

912bp

Gene Synonym

CTSZ, CTSX, FLJ17088

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cathepsin Z Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cathepsin Z (CTSZ), also known as Cathepsin X or CATX, belongs to the C1 family of lysosomal cysteine proteases. Its gene structure and activity properties show several unique features that distinguish it clearly from other human cysteine proteases. It has a very short pro-region that shows no similarity to those of other cathepsins and a three-residue insertion motif that forms a characteristic ‘mini loop’. Cathepsin Z exhibits mono- and di-peptidase activity at its C-terminus, and in contrast to cathepsin B, it does not act as an endopeptidase. It is restricted to the cells of theimmune system, predominantly monocytes, macrophages and dendritic cells. Cathepsin Z is widely expressed in human tissues, suggesting that this enzyme could be involved in the normal intracellular protein degradation taking place in all cell types. It is capable to cleave regulatory motifs at C-terminus affecting the function of targeted molecules. Cathepsin X may regulate also the maturation of dendritic cells, a process, which is crucial in the initiation of adaptive immunity. Furthermore, higher levels of Cathepsin Z are also found in tumour and immune cells of prostate and gastric carcinomas and inmacrophages of gastric mucosa, especially after infection by Helicobacter pylori. Cathepsin Z is also ubiquitously distributed in cancer cell lines and in primary tumors from different sources, suggesting that this enzyme may participate in tumor progression.

References

Santamara I, et al. (1998) Cathepsin Z, a novel human cysteine proteinase with a short propeptide domain and a unique chromosomal location. J Biol Chem. 273(27): 16816-23.

Kos J, et al. (2009) The role of cathepsin X in cell signaling. Cell Adh Migr. 3(2): 164-6.

Sevenich L, et al. (2010) Synergistic antitumor effects of combined cathepsin B and cathepsin Z deficiencies on breast cancer progression and metastasis in mice. Proc Natl Acad Sci U S A. 107(6): 2497-502.

Catalog Number:HGB921-NM