Human CSNK1G1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_022048.3

RefSeq ORF Size

1269bp

Gene Synonym

CSNK1G1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human casein kinase 1, gamma 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Casein kinase I isoform gamma-1, also known as CSNK1G1, is a member of the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. The casein kinase I family of protein kinases are serine / threonine-selective enzymes that function as regulators of signal transduction pathways in most eukaryotic cell types. Casein has been used as a substrate since the earliest days of research on protein phosphorylation. Casein kinase activity associated with the endoplasmic reticulum of mammary glands was first characterized in 1974 and its activity was shown to not depend on cyclic AMP. The CKI family of monomeric serine–threonine protein kinases is found in eukaryotic organisms from yeast to human. Mammals have seven family members: alpha, beta 1, gamma 1, gamma 2, gamma 3, delta, and epsilon. The family members have the highest homology in their kinase domains (53%–98% identical) and differ from most other protein kinases by the presence of the sequence S-I-N instead of A-P-E in kinase domain VIII. The CKI family members appear to have similar substrate specificity and substrate selection is thought to be regulated via subcellular localization and docking sites in specific substrates.

References

E. Bingham. et al.,1974, Journal of Biological Chemistry. 249: 3647-51.

Wojciech S. et al., 2004, Journal of Biological Chemistry.279: 13011-7.

L. Lum. et al., 2004, Science Volume 304, pages 1755-9.

R. Takada. et al., 2005, Genes Cells Volume 10: 919-28.

G. Davidson. et al., 2005, Nature Volume 438: 867-72.

Catalog Number:HGB878-CY