Human CRTAM Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_019604.2

RefSeq ORF Size

1182bp

Gene Synonym

ACE2, ACEH, DKFZP434A014

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cytotoxic and regulatory T cell molecule Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cytotoxic and regulatory T-cell molecule, also known as Class-I MHC-restricted T-cell-associated molecule and CRTAM, is a single-pass type I membrane protein which belongs to the nectin family. CRTAM contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. In the immune system, the expression of CRTAM is restricted to activated class-I MHC-restricted cells, including NKT and CD8 cells. It is strongly expressed in spleen, thymus, small intestine, peripheral blood leukocyte, and in purkinje neurons in cerebellum. It is expressed at much lower levels in testis, ovary, colon, lung and lymphoid tissues. CRTAM is a member of the immunoglobulin superfamily that complies with the structural characteristics of the JAM family of proteins and is phylogenetically more closely related to nectin-like proteins. It is a molecule involved in epithelial cell adhesion. CRTAM is sensitive to intermediate filament disruption and treatment of monolayers with soluble CRTAM enhances cell-cell dissociation and lowers transepithelial electrical resistance. CRTAM may also induce retention by binding to CD8+ dendritic cells (DCs) at the late stage of activation before proliferation.

References

Garay, E. et al., 2010, J Cell Biochem. 111 (1):111-22.

Medina-C.O. et al., 2010, Dev Comp Immunol. 34 (2):196-202.

Takeuchi, A. et al., 2009, J Immunol.183 (7):4220-8.

Valle-Rios,R. et al., 2009, Mol Immunol. 46 (16): 3379-87.

Catalog Number:HGB863-CM