Rat Cripto/TDGF1/ CRGF Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

XM_001056317.2

RefSeq ORF Size

546bp

Gene Synonym

Tdgf1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat teratocarcinoma-derived growth factor 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family member proteins share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. Before gastrulation, Cripto is asymmetrically expressed in a proximal–distal gradient in the epiblast, and subsequently is expressed in the primitive streak and newly formed embryonic mesoderm. These proteins play key roles in intercellular signaling pathways during vertebrate embryogenesis. Mutations in Cripto/TDGF1 can cause autosomal visceral heterotaxy. Cripto/TDGF1 is involved in left-right asymmetric morphogenesis during organ development. Cripto signalling is essential for the conversion of a proximal–distal asymmetry into an orthogonal anterior–posterior axis. The mechanism of inhibitory effects of the Cripto includes both cancer cell apoptosis, activation of c-Jun-NH(2)-terminal kinase and p38 kinase signaling pathways and blocking of Akt phosphorylation. Thus, Cripto is a unique target, and Immunohistochemistry to Cripto could be of therapeutic value for human cancers.

References

Calvanese L, et al. (2006) Solution structure of mouse Cripto CFC domain and its inactive variant Trp107Ala. J Med Chem. 49 (24): 7054-62.

Lonardo E, et al. (2010) A small synthetic cripto blocking Peptide improves neural induction, dopaminergic differentiation, and functional integration of mouse embryonic stem cells in a rat model of Parkinson's disease. Stem Cells. 28 (8): 1326-37.

Chambery A, et al. (2009) Qualitative and quantitative proteomic profiling of cripto(-/-) embryonic stem cells by means of accurate mass LC-MS analysis. J Proteome Res. 8 (2): 1047-58.

Catalog Number:HGB848-NY