Human CRELD1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGB841-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1263bp
Gene Synonym
AVSD2, CIRRIN, CRELD1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cysteine-rich with EGF-like domains 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CRELD1 is a transmembrane glycoprotein. Epidermal growth factor(EGF)­like domain exists in CRELD1. EGF-like repeats are a class of cysteine-rich domains that mediate interactions between proteins of diverse function. EGF domains are found in proteins that are either completely secreted or have transmembrane regions that tether the protein to the cell surface. CRELD1 contains a 333 amino acid acid (aa) extracellular domain (ECD), two tandem transmembrane segments, and a second ECD of 15 aa. Defects in CRELD1 may cause susceptibility to atrioventricular septal defect type 2 which results in a persistent common atrioventricular canal.
References
  • Robinson SW, et al. (2003) Missense Mutations in CRELD1 Are Associated with Cardiac Atrioventricular Septal Defects. Am J Hum Genet. 72(4):1047-52.
  • Zatyka M, et al. (2005) Analysis of CRELD1 as a candidate 3p25 atrioventicular septal defect locus (AVSD2). Clin Genet. 67(6):526-8.
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • TOP