Human CREB1 transcript variant A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGB835-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
984bp
Gene Synonym
CREB1, CREB, MGC9284
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cAMP responsive element binding protein 1, transcript variant A Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CAMP responsive element binding protein 1, also known as CREB-1, plays multiple functions as a transcription factor in gene regulation. This protein is a CREB transcription factor that is a member of the leucine zipper family of DNA-binding proteins. CREB1 proteins are also known to be expressed in several spliced isoforms that act as transcriptional activators or repressors. The activator isoforms, possessing the functional domains for kinase induction and for interaction with other transcriptional regulators, act as transcriptional activators.The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. CREB-1 has a complex influence on behavioural responses to drugs of abuse which varies depending on the brain region in which it is expressed. CREB-1 is important for serotonin (5-HT)-induced long-term facilitation (LTF) of the sensorimotor synapse in Aplysia. 
References
  • Sadamoto H, et al. (2011) Direct observation of dimerization between different CREB1 isoforms in a living cell. PLoS One. 6 (6): e20285.
  • Liu RY, et al. (2011) The requirement for enhanced CREB1 expression in consolidation of long-term synaptic facilitation and long-term excitability in sensory neurons of Aplysia. J Neurosci. 31 (18): 6871-9.
  • Hoeffler JP, et al. (1988) Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science. 242 (4884): 1430-3.
  • TOP